Stem-loop sequence mne-mir-17

AccessionMI0003019 (change log)
DescriptionMacaca nemestrina miR-17 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
       ga       -ca        a  g     g   -  au 
5' guca  auaaugu   aagugcuu ca ugcag uag ug  a
   ||||  |||||||   |||||||| || ||||| ||| ||  u
3' cagu  uauuacg   uucacgga gu acguc auc ac  g
       gg       aug        a  g     -   u  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-17-5p

Accession MIMAT0002721
Sequence

14 - 

caaagugcuuacagugcagguagu

 - 37

Get sequence
Evidence by similarity; MI0000071

Mature sequence mne-miR-17-3p

Accession MIMAT0002722
Sequence

51 - 

acugcagugaaggcacuugu

 - 70

Get sequence
Evidence by similarity; MI0000071

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).