Stem-loop sequence mml-mir-20a

AccessionMI0003004 (change log)
Previous IDsmml-mir-20
DescriptionMacaca mulatta miR-20a stem-loop
Gene family MIPF0000001; mir-17
Literature search

2 open access papers mention mml-mir-20a
(4 sentences)

Stem-loop
       c   -a                 g   -  uu 
5' guag acu  aagugcuuauagugcag uag ug  u
   |||| |||  ||||||||||||||||| ||| ||   
3' cguc uga  uucacgaguauuacguc auc au  a
       a   aa                 -   u  ug 
Get sequence
Deep sequencing
62905 reads, 522 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr17: 73096567-73096637 [+]
sense
ENSMMUT00000015929 ; GPC5-201; intron 1
Clustered miRNAs
< 10kb from mml-mir-20a
mml-mir-17chr17: 73096107-73096190 [+]
mml-mir-18achr17: 73096253-73096323 [+]
mml-mir-19achr17: 73096393-73096474 [+]
mml-mir-20achr17: 73096567-73096637 [+]
mml-mir-19b-1chr17: 73096694-73096780 [+]
mml-mir-92a-1chr17: 73096816-73096893 [+]
Database links

Mature sequence mml-miR-20a-5p

Accession MIMAT0002704
Previous IDsmml-miR-20
Sequence

8 - 

uaaagugcuuauagugcaggua

 - 29

Get sequence
Deep sequencing62748 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-20a-3p

Accession MIMAT0026597
Sequence

44 - 

acugcauuaugagcacuuaaagu

 - 66

Get sequence
Deep sequencing156 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).