Stem-loop sequence mml-mir-19a

AccessionMI0003003 (change log)
DescriptionMacaca mulatta miR-19a stem-loop
Gene family MIPF0000011; mir-19
Literature search

3 open access papers mention mml-mir-19a
(4 sentences)

Stem-loop
       u  u                 --      ---    ag 
5' gcag cc cuguuaguuuugcauag  uugcac   uaca  a
   |||| || |||||||||||||||||  ||||||   ||||  a
3' cguc gg gguagucaaaacguauc  aacgug   augu  g
       c  u                 ua      uug    aa 
Get sequence
Deep sequencing
6487 reads, 22.2 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr17: 73096393-73096474 [+]
sense
ENSMMUT00000015929 ; GPC5-201; intron 1
Clustered miRNAs
< 10kb from mml-mir-19a
mml-mir-17chr17: 73096107-73096190 [+]
mml-mir-18achr17: 73096253-73096323 [+]
mml-mir-19achr17: 73096393-73096474 [+]
mml-mir-20achr17: 73096567-73096637 [+]
mml-mir-19b-1chr17: 73096694-73096780 [+]
mml-mir-92a-1chr17: 73096816-73096893 [+]
Database links

Mature sequence mml-miR-19a-5p

Accession MIMAT0026596
Sequence

14 - 

aguuuugcauaguugcacuac

 - 34

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-19a-3p

Accession MIMAT0002703
Sequence

49 - 

ugugcaaaucuaugcaaaacuga

 - 71

Get sequence
Deep sequencing6477 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).