Stem-loop sequence mml-mir-18a

AccessionMI0003002 (change log)
Previous IDsmml-mir-18
DescriptionMacaca mulatta miR-18 stem-loop
Gene family MIPF0000001; mir-17
Literature search

3 open access papers mention mml-mir-18a
(7 sentences)

Stem-loop
   u   cu    u   uc   u    a   -  aa u 
5'  guu  aagg gca  uag gcag uag ug  g a
    |||  |||| |||  ||| |||| ||| ||  | g
3'  cgg  uucc cgu  auc cguc auc ac  u a
   a   uc    u   ga   c    -   u  ga u 
Get sequence
Deep sequencing
3018 reads, 11.1 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr17: 73096253-73096323 [+]
sense
ENSMMUT00000015929 ; GPC5-201; intron 1
Clustered miRNAs
< 10kb from mml-mir-18a
mml-mir-17chr17: 73096107-73096190 [+]
mml-mir-18achr17: 73096253-73096323 [+]
mml-mir-19achr17: 73096393-73096474 [+]
mml-mir-20achr17: 73096567-73096637 [+]
mml-mir-19b-1chr17: 73096694-73096780 [+]
mml-mir-92a-1chr17: 73096816-73096893 [+]
Database links

Mature sequence mml-miR-18a-5p

Accession MIMAT0002702
Previous IDsmml-miR-18
Sequence

6 - 

uaaggugcaucuagugcagaua

 - 27

Get sequence
Deep sequencing2820 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-18a-3p

Accession MIMAT0026595
Sequence

47 - 

acugcccuaagugcuccuucuggc

 - 70

Get sequence
Deep sequencing198 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).