Stem-loop sequence ptr-mir-20a

AccessionMI0002998 (change log)
Previous IDsptr-mir-20
DescriptionPan troglodytes miR-20a stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
       c   -a                 g   -  uu 
5' guag acu  aagugcuuauagugcag uag ug  u
   |||| |||  ||||||||||||||||| ||| ||   
3' cguc uga  uucacgaguauuacguc auc au  a
       a   aa                 -   u  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr13: 77007171-77007241 [+]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-20a
ptr-mir-17chr13: 77006711-77006794 [+]
ptr-mir-18achr13: 77006857-77006927 [+]
ptr-mir-19achr13: 77006997-77007078 [+]
ptr-mir-20achr13: 77007171-77007241 [+]
ptr-mir-19b-1chr13: 77007298-77007384 [+]
ptr-mir-92-1chr13: 77007420-77007497 [+]
Database links

Mature sequence ptr-miR-20a

Accession MIMAT0002697
Previous IDsptr-miR-20
Sequence

8 - 

uaaagugcuuauagugcaggua

 - 29

Get sequence
Evidence by similarity; MI0000076
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).