Stem-loop sequence ptr-mir-17

AccessionMI0002995 (change log)
DescriptionPan troglodytes miR-17 stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention ptr-mir-17
(1 sentences)

Stem-loop
       ga       -ca        a  g     g   -  au 
5' guca  auaaugu   aagugcuu ca ugcag uag ug  a
   ||||  |||||||   |||||||| || ||||| ||| ||  u
3' cagu  uauuacg   uucacgga gu acguc auc ac  g
       gg       aug        a  g     -   u  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr13: 77006711-77006794 [+]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-17
ptr-mir-17chr13: 77006711-77006794 [+]
ptr-mir-18achr13: 77006857-77006927 [+]
ptr-mir-19achr13: 77006997-77007078 [+]
ptr-mir-20achr13: 77007171-77007241 [+]
ptr-mir-19b-1chr13: 77007298-77007384 [+]
ptr-mir-92-1chr13: 77007420-77007497 [+]
Database links

Mature sequence ptr-miR-17-5p

Accession MIMAT0002693
Sequence

14 - 

caaagugcuuacagugcagguagu

 - 37

Get sequence
Evidence by similarity; MI0000071
Predicted targets

Mature sequence ptr-miR-17-3p

Accession MIMAT0002694
Sequence

51 - 

acugcagugaaggcacuugu

 - 70

Get sequence
Evidence by similarity; MI0000071
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).