Stem-loop sequence ppy-mir-19b-1

Accession MI0002993
Description Pongo pygmaeus miR-19b-1 stem-loop
Gene family MIPF0000011; mir-19
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-19_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

There maybe 89 known sequences today in the microRNA 19 (miR-19) family but it will change quickly. They are found in a large number of vertebrate species. The miR-19 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. Within the human and mouse genome there are three copies of this microRNA that are processed from multiple predicted precursor hairpins: mouse: * miR-19a on chromosome 14 (MI0000688) * miR-19b-1 on chromosome 14 (MI0000718) * miR-19b-2 on chromosome X (MI0000546) human: * miR-19a on chromosome 13 (MI0000073) * miR-19b-1 on chromosome 13 (MI0000074) * miR-19b-2 on chromosome X (MI000075). MiR-19 has now been predicted or experimentally confirmed (MIPF0000011). In this case the mature sequence is excised from the 3' arm of the hairpin precursor.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     uu                 -  -      uc    ugugu 
cacug  cuaugguuaguuuugca gg uuugca  cagc     g
|||||  ||||||||||||||||| || ||||||  ||||     a
gugau  ggugucagucaaaacgu cc aaacgu  gucg     u
     --                 a  u      --    ucuua 
Get sequence
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (PPYG2) Overlapping transcripts
13: 93460617-93460703 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-19b-1
ppy-mir-17 13: 93460030-93460113 [+]
ppy-mir-18a 13: 93460176-93460246 [+]
ppy-mir-19a 13: 93460316-93460397 [+]
ppy-mir-20a 13: 93460490-93460560 [+]
ppy-mir-19b-1 13: 93460617-93460703 [+]
Database links

Mature sequence ppy-miR-19b

Accession MIMAT0002691
Sequence

54 - 

ugugcaaauccaugcaaaacuga

 - 76

Get sequence
Evidence by similarity; MI0000074
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).