![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ppy-mir-20a |
||||||||||||||
Accession | MI0002992 (change log) | |||||||||||||
Previous IDs | ppy-mir-20 | |||||||||||||
Description | Pongo pygmaeus miR-20 stem-loop | |||||||||||||
Gene family | MIPF0000001; mir-17 | |||||||||||||
Literature search |
1 open access papers mention ppy-mir-20a | |||||||||||||
Stem-loop |
c -a g - uu 5' guag acu aagugcuuauagugcag uag ug u |||| ||| ||||||||||||||||| ||| || 3' cguc uga uucacgaguauuacguc auc au a a aa - u ug |
|||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||
Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
|||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
|
Mature sequence ppy-miR-20a |
|
Accession | MIMAT0002690 |
Previous IDs | ppy-miR-20 |
Sequence |
8 - uaaagugcuuauagugcaggua - 29 |
Evidence | by similarity; MI0000076 |
References |
|
1 |
PMID:15652478
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|