Stem-loop sequence ppy-mir-20a

Accession

MI0002992 (change log)

Previous IDs

ppy-mir-20

Description

Pongo pygmaeus miR-20 stem-loop

Gene family

MIPF0000001; mir-17

Literature search

1 open access papers mention ppy-mir-20a
(2 sentences)

Stem-loop

       c   -a                 g   -  uu 
5' guag acu  aagugcuuauagugcag uag ug  u
   |||| |||  ||||||||||||||||| ||| ||   
3' cguc uga  uucacgaguauuacguc auc au  a
       a   aa                 -   u  ug 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context

• Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4): chr13: 93460490-93460560 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from ppy-mir-20a

• ppy-mir-17: chr13: 93460030-93460113 [+]
• ppy-mir-18a: chr13: 93460176-93460246 [+]
• ppy-mir-19a: chr13: 93460316-93460397 [+]
• ppy-mir-20a: chr13: 93460490-93460560 [+]
• ppy-mir-19b-1: chr13: 93460617-93460703 [+]
• ppy-mir-92-1: chr13: 93460739-93460816 [+]

Database links

• miRBase Tracker:MI0002992

Mature sequence ppy-miR-20a

• Accession: MIMAT0002690
• Previous IDs: ppy-miR-20
• Sequence: 8 - uaaagugcuuauagugcaggua - 29
• Evidence: by similarity; MI0000076

References

1. PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).