Stem-loop sequence ppy-mir-20a

AccessionMI0002992 (change log)
Previous IDsppy-mir-20
DescriptionPongo pygmaeus miR-20 stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention ppy-mir-20a
(2 sentences)

Stem-loop
       c   -a                 g   -  uu 
5' guag acu  aagugcuuauagugcag uag ug  u
   |||| |||  ||||||||||||||||| ||| ||   
3' cguc uga  uucacgaguauuacguc auc au  a
       a   aa                 -   u  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr13: 93460490-93460560 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-20a
ppy-mir-17chr13: 93460030-93460113 [+]
ppy-mir-18achr13: 93460176-93460246 [+]
ppy-mir-19achr13: 93460316-93460397 [+]
ppy-mir-20achr13: 93460490-93460560 [+]
ppy-mir-19b-1chr13: 93460617-93460703 [+]
ppy-mir-92-1chr13: 93460739-93460816 [+]
Database links

Mature sequence ppy-miR-20a

Accession MIMAT0002690
Previous IDsppy-miR-20
Sequence

8 - 

uaaagugcuuauagugcaggua

 - 29

Get sequence
Evidence by similarity; MI0000076

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).