Stem-loop sequence ppa-mir-20

AccessionMI0002986 (change log)
DescriptionPan paniscus miR-20 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
       c   -a                 g   -  uu 
5' guag acu  aagugcuuauagugcag uag ug  u
   |||| |||  ||||||||||||||||| ||| ||   
3' cguc uga  uucacgaguauuacguc auc au  a
       a   aa                 -   u  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (panpan1.1; GCA_000258655.2) Overlapping transcripts
chr13: 91707788-91707858 [+]
intergenic
Clustered miRNAs
< 10kb from ppa-mir-20
ppa-mir-17chr13: 91707328-91707411 [+]
ppa-mir-18chr13: 91707474-91707544 [+]
ppa-mir-19achr13: 91707614-91707695 [+]
ppa-mir-20chr13: 91707788-91707858 [+]
ppa-mir-19b-1chr13: 91707915-91708001 [+]
ppa-mir-92a-1chr13: 91708037-91708114 [+]
Database links

Mature sequence ppa-miR-20

Accession MIMAT0002683
Sequence

8 - 

uaaagugcuuauagugcaggua

 - 29

Get sequence
Evidence by similarity; MI0000076

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).