Stem-loop sequence ppa-mir-17

AccessionMI0002983 (change log)
DescriptionPan paniscus miR-17 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
       ga       -ca        a  g     g   -  au 
5' guca  auaaugu   aagugcuu ca ugcag uag ug  a
   ||||  |||||||   |||||||| || ||||| ||| ||  u
3' cagu  uauuacg   uucacgga gu acguc auc ac  g
       gg       aug        a  g     -   u  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (panpan1.1; GCA_000258655.2) Overlapping transcripts
chr13: 91707328-91707411 [+]
intergenic
Clustered miRNAs
< 10kb from ppa-mir-17
ppa-mir-17chr13: 91707328-91707411 [+]
ppa-mir-18chr13: 91707474-91707544 [+]
ppa-mir-19achr13: 91707614-91707695 [+]
ppa-mir-20chr13: 91707788-91707858 [+]
ppa-mir-19b-1chr13: 91707915-91708001 [+]
ppa-mir-92a-1chr13: 91708037-91708114 [+]
Database links

Mature sequence ppa-miR-17-5p

Accession MIMAT0002679
Sequence

14 - 

caaagugcuuacagugcagguagu

 - 37

Get sequence
Evidence by similarity; MI0000071

Mature sequence ppa-miR-17-3p

Accession MIMAT0002680
Sequence

51 - 

acugcagugaaggcacuugu

 - 70

Get sequence
Evidence by similarity; MI0000071

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).