Stem-loop sequence lca-mir-18

AccessionMI0002972 (change log)
DescriptionLemur catta miR-18 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   u   cu    u   uc   u    a   -  aa u 
5'  guu  aagg gca  uag gcag uag ug  g a
    |||  |||| |||  ||| |||| ||| ||  | g
3'  cgg  uucc cgu  auc cguc auc ac  u a
   a   uc    u   ga   c    -   u  ga u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence lca-miR-18

Accession MIMAT0002667
Sequence

6 - 

uaaggugcaucuagugcagaua

 - 27

Get sequence
Evidence by similarity; MI0000072

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).