Stem-loop sequence ggo-mir-18a

Accession MI0002966
Previous IDs ggo-mir-18
Description Gorilla gorilla miR-18 stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u   cu    u   uc   u    a   -  aa u 
 guu  aagg gca  uag gcag uag ug  g a
 |||  |||| |||  ||| |||| ||| ||  | g
 cgg  uucc cgu  auc cguc auc ac  u a
a   uc    u   ga   c    -   u  ga u 
Get sequence
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (GorGor3) Overlapping transcripts
13: 74257348-74257418 [+]
sense
Clustered miRNAs
< 10kb from ggo-mir-18a
ggo-mir-17 13: 74257202-74257285 [+]
ggo-mir-18a 13: 74257348-74257418 [+]
ggo-mir-19a 13: 74257488-74257569 [+]
ggo-mir-20a 13: 74257662-74257732 [+]
ggo-mir-19b-1 13: 74257789-74257875 [+]
ggo-mir-92-1 13: 74257911-74257988 [+]
Database links

Mature sequence ggo-miR-18a

Accession MIMAT0002660
Previous IDs ggo-miR-18
Sequence

6 - 

uaaggugcaucuagugcagaua

 - 27

Get sequence
Evidence by similarity; MI0000072
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).