Stem-loop sequence ggo-mir-18a

AccessionMI0002966 (change log)
Previous IDsggo-mir-18
DescriptionGorilla gorilla miR-18 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   u   cu    u   uc   u    a   -  aa u 
5'  guu  aagg gca  uag gcag uag ug  g a
    |||  |||| |||  ||| |||| ||| ||  | g
3'  cgg  uucc cgu  auc cguc auc ac  u a
   a   uc    u   ga   c    -   u  ga u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr13: 74168337-74168407 [+]
sense
ENSGGOT00000036649 ; ggo-mir-18a-201; exon 1
Clustered miRNAs
< 10kb from ggo-mir-18a
ggo-mir-17chr13: 74168191-74168274 [+]
ggo-mir-18achr13: 74168337-74168407 [+]
ggo-mir-19achr13: 74168477-74168558 [+]
ggo-mir-20achr13: 74168651-74168721 [+]
ggo-mir-19b-1chr13: 74168778-74168864 [+]
ggo-mir-92-1chr13: 74168900-74168977 [+]
Database links

Mature sequence ggo-miR-18a

Accession MIMAT0002660
Previous IDsggo-miR-18
Sequence

6 - 

uaaggugcaucuagugcagaua

 - 27

Get sequence
Evidence by similarity; MI0000072

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).