Stem-loop sequence lla-mir-16

AccessionMI0002964 (change log)
DescriptionLagothrix lagotricha miR-16 stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
         ag   c          -  a        c c   gauu 
5' gucagc  ugc uuagcagcac gu aauauugg g uaa    c
   ||||||  ||| |||||||||| || |||||||| | |||     
3' cgguug  aug agucgucgug ca uuaugacc c auu    u
         ga   a          u  a        u u   aaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence lla-miR-16

Accession MIMAT0002657
Sequence

14 - 

uagcagcacguaaauauuggcg

 - 35

Get sequence
Evidence by similarity; MI0000070

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).