Stem-loop sequence lla-mir-15a

AccessionMI0002963 (change log)
DescriptionLagothrix lagotricha miR-15a stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
        gaguaaa ua        ua          ga  u 
5' ccuug       g  gcagcaca  augguuugug  uu u
   |||||       |  ||||||||  ||||||||||  || g
3' ggaac       c  cgucgugu  uaccggacgu  aa a
        auaaaaa uc        ua          gg  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence lla-miR-15a

Accession MIMAT0002656
Sequence

14 - 

uagcagcacauaaugguuugug

 - 35

Get sequence
Evidence by similarity; MI0000069

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).