Stem-loop sequence ptr-mir-16-1

AccessionMI0002962 (change log)
Previous IDsptr-mir-16
DescriptionPan troglodytes miR-16-1 stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
         ag   c          -  a        c u   gauu 
5' gucagc  ugc uuagcagcac gu aauauugg g uaa    c
   ||||||  ||| |||||||||| || |||||||| | |||     
3' caguug  aug agucgucgug ca uuaugacc c auu    u
         ga   a          u  a        u u   aaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr13: 35079532-35079620 [-]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-16-1
ptr-mir-15achr13: 35079678-35079760 [-]
ptr-mir-16-1chr13: 35079532-35079620 [-]
Database links

Mature sequence ptr-miR-16

Accession MIMAT0002655
Sequence

14 - 

uagcagcacguaaauauuggcg

 - 35

Get sequence
Evidence by similarity; MI0000115
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).