Stem-loop sequence ppy-mir-15a

AccessionMI0002959 (change log)
DescriptionPongo pygmaeus miR-15a stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
        gaguaaa ua        ua          ga  u 
5' ccuug       g  gcagcaca  augguuugug  uu u
   |||||       |  ||||||||  ||||||||||  || g
3' ggaac       c  cgucgugu  uaccggacgu  aa a
        auaaaaa uc        ua          gg  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr13: 50305217-50305299 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-15a
ppy-mir-15achr13: 50305217-50305299 [-]
ppy-mir-16-1chr13: 50305071-50305159 [-]
Database links

Mature sequence ppy-miR-15a

Accession MIMAT0002652
Sequence

14 - 

uagcagcacauaaugguuugug

 - 35

Get sequence
Evidence by similarity; MI0000069

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).