Stem-loop sequence mml-mir-16-1

AccessionMI0002958 (change log)
Previous IDsmml-mir-16
DescriptionMacaca mulatta miR-16-1 stem-loop
Gene family MIPF0000006; mir-15
Literature search

3 open access papers mention mml-mir-16-1
(4 sentences)

Stem-loop
         ag   c          -  a        c u   gauu 
5' gucagc  ugc uuagcagcac gu aauauugg g uaa    c
   ||||||  ||| |||||||||| || |||||||| | |||     
3' caguug  aug agucgucgug ca uuaugacc c auu    u
         ga   a          u  a        u u   aaaa 
Get sequence
Deep sequencing
130406 reads, 889 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [2]. The expression of this mature miRNA was validated by Miska et al [1].

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr17: 29400064-29400152 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-16-1
mml-mir-15achr17: 29400210-29400292 [-]
mml-mir-16-1chr17: 29400064-29400152 [-]
Database links

Mature sequence mml-miR-16-5p

Accession MIMAT0002651
Sequence

14 - 

uagcagcacguaaauauuggcg

 - 35

Get sequence
Deep sequencing260352 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-16-1-3p

Accession MIMAT0026594
Sequence

56 - 

ccaguauuaacugugcugcugaa

 - 78

Get sequence
Deep sequencing235 reads, 9 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).