Stem-loop sequence mml-mir-15a

AccessionMI0002957 (change log)
DescriptionMacaca mulatta miR-15a stem-loop
Gene family MIPF0000006; mir-15
Literature search

1 open access papers mention mml-mir-15a
(2 sentences)

Stem-loop
        gaguaaa ua        ua          ga  u 
5' ccuug       g  gcagcaca  augguuugug  uu u
   |||||       |  ||||||||  ||||||||||  || g
3' ggaac       c  cgucgugu  uaccggacgu  aa a
        auaaaaa uc        ua          gg  a 
Get sequence
Deep sequencing
24846 reads, 133 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr17: 29400210-29400292 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-15a
mml-mir-15achr17: 29400210-29400292 [-]
mml-mir-16-1chr17: 29400064-29400152 [-]
Database links

Mature sequence mml-miR-15a-5p

Accession MIMAT0002650
Sequence

14 - 

uagcagcacauaaugguuugug

 - 35

Get sequence
Deep sequencing24813 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-15a-3p

Accession MIMAT0026593
Sequence

50 - 

gcaggccauauugugcugccuca

 - 72

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).