Stem-loop sequence ppa-mir-16

AccessionMI0002954 (change log)
DescriptionPan paniscus miR-16 stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
         ag   c          -  a        c u   gauu 
5' gucagc  ugc uuagcagcac gu aauauugg g uaa    c
   ||||||  ||| |||||||||| || |||||||| | |||     
3' caguug  aug agucgucgug ca uuaugacc c auu    u
         ga   a          u  a        u u   aaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (panpan1.1; GCA_000258655.2) Overlapping transcripts
chr13: 49936089-49936177 [-]
intergenic
Clustered miRNAs
< 10kb from ppa-mir-16
ppa-mir-15achr13: 49936235-49936317 [-]
ppa-mir-16chr13: 49936089-49936177 [-]
Database links

Mature sequence ppa-miR-16

Accession MIMAT0002647
Sequence

14 - 

uagcagcacguaaauauuggcg

 - 35

Get sequence
Evidence by similarity; MI0000070

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).