Stem-loop sequence age-mir-16

Accession MI0002946
Description Ateles geoffroyi miR-16 stem-loop
Gene family MIPF0000006; mir-15
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-16_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-16 microRNA precursor family is a group of related small non-coding RNA genes that regulates gene expression. miR-16, miR-15, mir-195 and miR-457 are related microRNA precursor sequences from the mir-15 gene family. This microRNA family appears to be vertebrate specific and its members have been predicted or experimentally validated in a wide range of vertebrate species (MIPF0000006).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      ag   c          -  a        c u   gauu 
gucagc  ugc uuagcagcac gu aauauugg g uaa    c
||||||  ||| |||||||||| || |||||||| | |||     
caguug  aug agucgucgug ca uuaugacc c auu    u
      ga   a          u  a        u u   aaaa 
Get sequence
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence age-miR-16

Accession MIMAT0002639
Sequence

14 - 

uagcagcacguaaauauuggcg

 - 35

Get sequence
Evidence by similarity; MI0000070

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).