Stem-loop sequence ggo-mir-181b

AccessionMI0002938 (change log)
DescriptionGorilla gorilla miR-181b stem-loop
Gene family MIPF0000007; mir-181
Literature search

1 open access papers mention ggo-mir-181b
(8 sentences)

Stem-loop
   ccugugcagagauuauuuuuuaaaa       aucaa         cug          gaa  g 
5'                          ggucaca     cauucauug   ucgguggguu   cu u
                            |||||||     |||||||||   ||||||||||   ||  
3'                          ccggugu     guaaguaac   agucacucga   gg g
   -------------------uucgcc       -caac         --a          aca  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr1: 178420004-178420113 [+]
intergenic
chr1: 178443659-178443768 [-]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-181b
ggo-mir-181a-1chr1: 178419833-178419942 [+]
ggo-mir-181bchr1: 178420004-178420113 [+]
ggo-mir-181bchr1: 178443659-178443768 [-]
ggo-mir-181a-1chr1: 178443830-178443939 [-]
Database links

Mature sequence ggo-miR-181b

Accession MIMAT0002630
Sequence

36 - 

aacauucauugcugucgguggguu

 - 59

Get sequence
Evidence by similarity; MI0000270

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).