Stem-loop sequence ggo-mir-181a-1

AccessionMI0002937 (change log)
Previous IDsggo-mir-213
DescriptionGorilla gorilla miR-181a-1 stem-loop
Gene family MIPF0000007; mir-181
Literature search

1 open access papers mention ggo-mir-181a-1
(9 sentences)

Stem-loop
   -u   -uuu   -    -   uc  u a   u      cu       a    g  au 
5'   gag    uga gguu gcu  ag g aca ucaacg  gucggug guuu ga  u
     |||    ||| |||| |||  || | ||| ||||||  ||||||| |||| ||  a
3'   cuc    acu ccaa cgg  uc c ugu aguugc  cagcuac caaa cu  a
   ac   uucu   a    u   ua  c a   u      --       -    a  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr1: 178419833-178419942 [+]
intergenic
chr1: 178443830-178443939 [-]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-181a-1
ggo-mir-181a-1chr1: 178419833-178419942 [+]
ggo-mir-181bchr1: 178420004-178420113 [+]
ggo-mir-181bchr1: 178443659-178443768 [-]
ggo-mir-181a-1chr1: 178443830-178443939 [-]
Database links

Mature sequence ggo-miR-181a-5p

Accession MIMAT0002503
Previous IDsggo-miR-181a
Sequence

24 - 

aacauucaacgcugucggugagu

 - 46

Get sequence
Evidence by similarity; MI0000289

Mature sequence ggo-miR-181a-3p

Accession MIMAT0002629
Previous IDsggo-miR-213;ggo-miR-181a*
Sequence

64 - 

accaucgaccguugauuguacc

 - 85

Get sequence
Evidence by similarity; MI0000289

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).