Stem-loop sequence ptr-mir-181a-1

AccessionMI0002933 (change log)
Previous IDsptr-mir-213
DescriptionPan troglodytes miR-181a-1 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop 
   -u    -uu   -    -   uc  u a   u      cu       a    g  au 
5'   gagu   uga gguu gcu  ag g aca ucaacg  gucggug guuu ga  u
     ||||   ||| |||| |||  || | ||| ||||||  ||||||| |||| ||  a
3'   cuca   acu ccaa cgg  uc c ugu aguugc  cagcuac caaa cu  a
   ac    ucu   a    u   ua  c a   u      --       -    a  aa
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr1: 177685358-177685467 [-]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-181a-1
ptr-mir-181a-1chr1: 177685358-177685467 [-]
ptr-mir-181b-1chr1: 177685189-177685296 [-]
Database links

Mature sequence ptr-miR-181a-5p

Accession MIMAT0002505
Previous IDsptr-miR-181a
Sequence

24 -  

aacauucaacgcugucggugagu

 - 46

Get sequence
Evidence by similarity; MI0000289
Predicted targets

Mature sequence ptr-miR-181a-3p

Accession MIMAT0002624
Previous IDsptr-miR-213;ptr-miR-181a*
Sequence

64 -  

accaucgaccguugauuguacc

 - 85

Get sequence
Evidence by similarity; MI0000289
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).