![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ptr-mir-181a-1 |
||||||
Accession | MI0002933 (change log) | |||||
Previous IDs | ptr-mir-213 | |||||
Description | Pan troglodytes miR-181a-1 stem-loop | |||||
Gene family | MIPF0000007; mir-181 | |||||
Stem-loop |
-u -uu - - uc u a u cu a g au 5' gagu uga gguu gcu ag g aca ucaacg gucggug guuu ga u |||| ||| |||| ||| || | ||| |||||| ||||||| |||| || a 3' cuca acu ccaa cgg uc c ugu aguugc cagcuac caaa cu a ac ucu a u ua c a u -- - a aa |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence ptr-miR-181a-5p |
|
Accession | MIMAT0002505 |
Previous IDs | ptr-miR-181a |
Sequence |
24 - aacauucaacgcugucggugagu - 46 |
Evidence | by similarity; MI0000289 |
Predicted targets |
|
Mature sequence ptr-miR-181a-3p |
|
Accession | MIMAT0002624 |
Previous IDs | ptr-miR-213;ptr-miR-181a* |
Sequence |
64 - accaucgaccguugauuguacc - 85 |
Evidence | by similarity; MI0000289 |
Predicted targets |
|
References |
|
1 |
PMID:15652478
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|