Stem-loop sequence mml-mir-181b-1

AccessionMI0002932 (change log)
Previous IDsmml-mir-181b
DescriptionMacaca mulatta miR-181b-1 stem-loop
Gene family MIPF0000007; mir-181
Literature search

3 open access papers mention mml-mir-181b-1
(7 sentences)

Stem-loop
   ccugugcagagauuauuuuuuaaaa       aucaa         cug          gaa  g 
5'                          ggucaca     cauucauug   ucgguggguu   cu u
                            |||||||     |||||||||   ||||||||||   ||  
3'                          ccggugu     guaaguaac   agucacucga   ga g
   -------------------uucgcc       -caac         --a          aca  u 
Get sequence
Deep sequencing
599022 reads, 2.87e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [2]. The expression of this mature miRNA was validated by Miska et al [1].

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 167910438-167910547 [+]
antisense
ENSMMUT00000030466 ; NEK7-201; intron 5
Clustered miRNAs
< 10kb from mml-mir-181b-1
mml-mir-181a-1chr1: 167910267-167910376 [+]
mml-mir-181b-1chr1: 167910438-167910547 [+]
Database links

Mature sequence mml-miR-181b-5p

Accession MIMAT0002623
Sequence

36 - 

aacauucauugcugucgguggguu

 - 59

Get sequence
Deep sequencing1195673 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-181b-1-3p

Accession MIMAT0026592
Sequence

79 - 

acugaacaaugaaugcaac

 - 97

Get sequence
Deep sequencing1452 reads, 9 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).