Stem-loop sequence ggo-mir-224

AccessionMI0002905 (change log)
DescriptionGorilla gorilla miR-224 stem-loop
Gene family MIPF0000088; mir-224
Stem-loop 
          ca         u   u      a u   ug  u 
5' gggcuuu  agucacuag ggu ccguuu g aga  au g
   |||||||  ||||||||| ||| |||||| | |||  || u
3' cccgaaa  ucagugauc ccg gguaaa c uuu  ua g
          ca         -   u      a -   gu  c
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chrX: 152183510-152183590 [-]
sense
ENSGGOT00000001385 ; GABRE-201; intron 6
Clustered miRNAs
< 10kb from ggo-mir-224
ggo-mir-452chrX: 152184539-152184651 [-]
ggo-mir-224chrX: 152183510-152183590 [-]
Database links

Mature sequence ggo-miR-224

Accession MIMAT0002596
Sequence

8 -  

caagucacuagugguuccguuua

 - 30

Get sequence
Evidence by similarity; MI0000301

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).