![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ggo-mir-224 |
||||||
Accession | MI0002905 (change log) | |||||
Description | Gorilla gorilla miR-224 stem-loop | |||||
Gene family | MIPF0000088; mir-224 | |||||
Stem-loop |
ca u u a u ug u 5' gggcuuu agucacuag ggu ccguuu g aga au g ||||||| ||||||||| ||| |||||| | ||| || u 3' cccgaaa ucagugauc ccg gguaaa c uuu ua g ca - u a - gu c |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence ggo-miR-224 |
|
Accession | MIMAT0002596 |
Sequence |
8 - caagucacuagugguuccguuua - 30 |
Evidence | by similarity; MI0000301 |
References |
|
1 |
PMID:15652478
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|