Stem-loop sequence ptr-mir-224

Accession MI0002904
Description Pan troglodytes miR-224 stem-loop
Gene family MIPF0000088; mir-224
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-224. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-224 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       ca         u   u      a u   ug  u 
gggcuuu  agucacuag ggu ccguuu g aga  au g
|||||||  ||||||||| ||| |||||| | |||  || u
cccgaaa  ucagugauc ccg gguaaa c uuu  ua g
       ca         -   u      a -   gu  c 
Get sequence
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (PanTro2.1.4) Overlapping transcripts
X: 152750954-152751034 [-]
sense
Clustered miRNAs
< 10kb from ptr-mir-224
ptr-mir-452 X: 152752005-152752088 [-]
ptr-mir-224 X: 152750954-152751034 [-]
Database links

Mature sequence ptr-miR-224

Accession MIMAT0002595
Sequence

8 - 

caagucacuagugguuccguuua

 - 30

Get sequence
Evidence by similarity; MI0000301
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).