Stem-loop sequence mml-mir-224

AccessionMI0002903 (change log)
DescriptionMacaca mulatta miR-224 stem-loop
Gene family MIPF0000088; mir-224
Literature search

1 open access papers mention mml-mir-224
(2 sentences)

Stem-loop
          ca         u   u      a u   ug  u 
5' gggcuuu  agucacuag ggu ccguuu g aga  au g
   |||||||  ||||||||| ||| |||||| | |||  || u
3' cccgaaa  ucagugauc ccg gguaaa c uuu  ua g
          ca         -   u      a -   gu  c 
Get sequence
Deep sequencing
1699 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 145593499-145593579 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-224
mml-mir-452chrX: 145594534-145594618 [-]
mml-mir-224chrX: 145593499-145593579 [-]
Database links

Mature sequence mml-miR-224-5p

Accession MIMAT0002594
Sequence

8 - 

caagucacuagugguuccguuua

 - 30

Get sequence
Deep sequencing1663 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-224-3p

Accession MIMAT0026591
Sequence

56 - 

auggugcccuagugacuacaa

 - 76

Get sequence
Deep sequencing36 reads, 6 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).