Stem-loop sequence ppa-mir-223

AccessionMI0002902 (change log)
DescriptionPan paniscus miR-223 stem-loop
Gene family MIPF0000067; mir-223
Stem-loop
   c    ccuccu   -     a    cc u              gaguug       cau 
5'  cugg      gca gugcc cgcu  g guauuugacaagcu      gacacuc   g
    ||||      ||| ||||| ||||  | ||||||||||||||      |||||||   u
3'  gacc      cgu cacgg guga  c cauaaacuguuuga      cugugag   g
   -    ---auu   a     c    ac c              ------       aug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (panpan1.1; GCA_000258655.2) Overlapping transcripts
chrX: 65208444-65208553 [+]
intergenic
Database links

Mature sequence ppa-miR-223

Accession MIMAT0002593
Sequence

68 - 

ugucaguuugucaaauacccc

 - 88

Get sequence
Evidence by similarity; MI0000300

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).