Stem-loop sequence mml-mir-223

AccessionMI0002897 (change log)
DescriptionMacaca mulatta miR-223 stem-loop
Gene family MIPF0000067; mir-223
Literature search

2 open access papers mention mml-mir-223
(5 sentences)

Stem-loop
   ccc  ccuccu   -     a    cc u              gaguug       cgu 
5'    gg      gca gugcc cgcu  g guauuugacaagcu      gacacuc   g
      ||      ||| ||||| ||||  | ||||||||||||||      |||||||   u
3'    cc      cgu uacgg guga  c cauaaacuguuuga      cugugag   g
   -ga  ---auu   a     c    ac c              ------       aug 
Get sequence
Deep sequencing
856 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 60234773-60234882 [+]
intergenic
Database links

Mature sequence mml-miR-223

Accession MIMAT0002588
Sequence

68 - 

ugucaguuugucaaauacccc

 - 88

Get sequence
Deep sequencing821 reads, 9 experiments
Evidence by similarity; MI0000300
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).