Stem-loop sequence mml-mir-221

AccessionMI0002892 (change log)
DescriptionMacaca mulatta miR-221 stem-loop
Gene family MIPF0000051; mir-221
Stem-loop
   -u     ----       cugg   a    -  ug   u         auuu    -   c 
5'   gaaca    uccaggu    ggc ugaa cc  gca acaauguag    cugu guu g
     |||||    |||||||    ||| |||| ||  ||| |||||||||    |||| ||| u
3'   cuugu    aggucca    ucg acuu gg  cgu uguuacauc    gaca cgg u
   cu     acaa       ----   g    u  gu   c         ----    a   a 
Get sequence
Deep sequencing
59946 reads, 144 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [2]. The expression of this mature miRNA was validated by Miska et al [1].

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 45879461-45879570 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-221
mml-mir-222chrX: 45880323-45880432 [-]
mml-mir-221chrX: 45879461-45879570 [-]
Database links

Mature sequence mml-miR-221-5p

Accession MIMAT0026590
Sequence

25 - 

accuggcauacaauguagauuucugu

 - 50

Get sequence
Deep sequencing9451 reads, 9 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence mml-miR-221-3p

Accession MIMAT0002583
Sequence

65 - 

agcuacauugucugcuggguuuc

 - 87

Get sequence
Deep sequencing50486 reads, 9 experiments
Evidence experimental; cloned [1], Illumina [3]
Database links
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).