Stem-loop sequence mml-mir-219-1

AccessionMI0002884 (change log)
Previous IDsmml-mir-219
DescriptionMacaca mulatta miR-219-1 stem-loop
Gene family MIPF0000044; mir-219
Stem-loop
   ccg    -----------    c       cu   u     a  g         a   uau 
5'    cccc           gggc gcggcuc  gau gucca ac caauucucg guc   g
      ||||           |||| |||||||  ||| ||||| || ||||||||| |||   g
3'    gggg           cccg cgccgag  cug caggu ug guugagagc cgg   c
   --g    agcuccaaacc    c       cc   -     c  a         -   ucu 
Get sequence
Deep sequencing
2067 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr4: 34051822-34051931 [+]
intergenic
Database links

Mature sequence mml-miR-219

Accession MIMAT0002575
Sequence

21 - 

ugauuguccaaacgcaauucu

 - 41

Get sequence
Deep sequencing1611 reads, 7 experiments
Evidence by similarity; MI0000296
Database links
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).