Stem-loop sequence mml-mir-218-2

AccessionMI0002880 (change log)
Previous IDsmml-mir-218
DescriptionMacaca mulatta miR-218-2 stem-loop
Gene family MIPF0000026; mir-218
Stem-loop
   gac   --uc  u    g       uuu         cu        gguggaacga  g 
5'    cag    gc gcgg gcuuucc   gugcuugau  aaccaugu          ug a
      |||    || |||| |||||||   |||||||||  ||||||||          ||  
3'    guc    cg ugcc cgaaagg   cacgaacug  uugguaca          gc a
   -ac   cucu  -    a       cgc         uc        --------ag  a 
Get sequence
Deep sequencing
29246 reads, 111 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr6: 167032434-167032543 [-]
intergenic
Database links

Mature sequence mml-miR-218-5p

Accession MIMAT0002574
Sequence

25 - 

uugugcuugaucuaaccaugu

 - 45

Get sequence
Deep sequencing56537 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-218-2-3p

Accession MIMAT0026589
Sequence

68 - 

augguucugucaagcaccgcg

 - 88

Get sequence
Deep sequencing836 reads, 6 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).