|
miRBase |
|
miRBase has moved to http://www.mirbase.org/ - please update your links.
Stem-loop sequence MI0002879 |
|||||
| Accession | MI0002879 | ||||
| ID | ptr-mir-218-2 | ||||
| Description | Pan troglodytes miR-218-2 stem-loop | ||||
| Stem-loop |
gac --uc u g uuu cu gguggaacga g cag gc gcgg gcuuucc gugcuugau aaccaugu ug a ||| || |||| ||||||| ||||||||| |||||||| || guc cg ugcc cgaaagg cacgaacug uugguaca gc a -ac cucu - a cgc uc --------ag a |
||||
| Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
||||
| Genome context |
|
||||
| Database links |
|
||||
| Gene family |
MIPF0000026; mir-218 |
||||
Mature sequence MIMAT0002570 |
|
| Accession | MIMAT0002570 |
| ID | ptr-miR-218 |
| Sequence |
25 - uugugcuugaucuaaccaugu - 45 |
| Evidence | by similarity; MI0000295 |
| Predicted targets |
|
References |
|
| 1 |
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|