Stem-loop sequence lca-mir-218

Accession MI0002871
Description Lemur catta miR-218 stem-loop
Gene family MIPF0000026; mir-218
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-218_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-218 microRNA precursor is a small non-coding RNA that regulates gene expression by antisense binding. miR-218 appears to be a vertebrate specific microRNA and has now been predicted and experimentally confirmed in a wide range of vertebrate species. The extents of the hairpin precursors are not known. In this case the mature sequence in excised from the 5'arm of the hairpin. miR-218, along with miR-585, has been found to be silenced by DNA methylation in oral squamous cell carcinoma. It is also downregulated in Nasopharyngeal carcinoma, with artificially-induced expression serving to slow tumour growth. miR-218 has also been found to have tumour suppressing qualities in bladder cancer cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-   au  u  a   a   u      u         cu        gg    -  g 
 gug  aa gu gcg gau uucugu gugcuugau  aaccaugu  uugc ca g
 |||  || || ||| ||| |||||| |||||||||  ||||||||  |||| ||  
 cau  uu cg cgc cug aaggua cacgaacug  uugguaca  aaug gu u
a   cu  -  a   a   c      c         cc        -a    a  a 
Get sequence
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence lca-miR-218

Accession MIMAT0002568
Sequence

25 - 

uugugcuugaucuaaccaugu

 - 45

Get sequence
Evidence by similarity; MI0000294
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).