|
miRBase |
|
Stem-loop sequence ggo-mir-217 |
|||||||
| Accession | MI0002866 | ||||||
| Description | Gorilla gorilla miR-217 stem-loop | ||||||
| Gene family | MIPF0000077; mir-217 | ||||||
| Stem-loop |
aguauaauuauuacaua uu c c a c c u - aag guuu gaugu g ag ua ugcau aggaacugau g gau a |||| ||||| | || || ||||| |||||||||| | ||| caaa cuacg c uc gu acgua uccuugacua c cug a --------------gaa -u a u c u a c a acu |
||||||
| Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
||||||
| Genome context |
|
||||||
| Database links |
|
||||||
Mature sequence ggo-miR-217 |
|
| Accession | MIMAT0002563 |
| Sequence |
35 - uacugcaucaggaacugauuggau - 58 |
| Evidence | by similarity; MI0000293 |
| Predicted targets |
|
References |
|
| 1 |
PMID:15652478
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|