Stem-loop sequence mne-mir-214

Accession MI0002860
Description Macaca nemestrina miR-214 stem-loop
Gene family MIPF0000062; mir-214
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-214. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-214 is a family of microRNA precursors found in animals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
ggccu      acaga           u          aca            aacau 
     ggcugg     guugucaugug cugccugucu   cuugcugugcag     c
     ||||||     ||||||||||| ||||||||||   ||||||||||||     c
     ccgacc     caacaguacac gacggacaga   ggacgacauguc     g
----u      -----           u          cac            cacuc 
Get sequence
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-214

Accession MIMAT0002557
Sequence

71 - 

acagcaggcacagacaggcag

 - 91

Get sequence
Evidence by similarity; MI0000290
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).