Stem-loop sequence mml-mir-214

AccessionMI0002858 (change log)
DescriptionMacaca mulatta miR-214 stem-loop
Gene family MIPF0000062; mir-214
Literature search

1 open access papers mention mml-mir-214
(1 sentences)

Stem-loop
   ggccu      acaga           u          aca            aacau 
5'      ggcugg     guugucaugug cugccugucu   cuugcugugcag     c
        ||||||     ||||||||||| ||||||||||   ||||||||||||     c
3'      ccgacc     caacaguacac gacggacaga   ggacgacauguc     g
   ----u      -----           u          cac            cacuc 
Get sequence
Deep sequencing
3254 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 195417710-195417819 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-214
mml-mir-199a-1chr1: 195411983-195412092 [+]
mml-mir-214chr1: 195417710-195417819 [+]
Database links

Mature sequence mml-miR-214-5p

Accession MIMAT0026588
Sequence

30 - 

ugccugucuacacuugcugugc

 - 51

Get sequence
Deep sequencing781 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-214-3p

Accession MIMAT0002555
Sequence

71 - 

acagcaggcacagacaggcag

 - 91

Get sequence
Deep sequencing2463 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).