Stem-loop sequence ptr-mir-204

Accession

MI0002838

Description

Pan troglodytes miR-204 stem-loop

Gene family

MIPF0000042; mir-204

Stem-loop

ggcuacagucuuucu   -  -    ucg     u          a     u    gagaau 
               uca ug ugac   uggac ucccuuuguc uccua gccu      a
               ||| || ||||   ||||| |||||||||| ||||| ||||      u
               ggu ac acug   acuug agggaaacgg agggu cgga      a
--------------c   c  u    uua     c          a     -    ggaagu 

Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context

• Coordinates (PanTro2.1.4): 9: 69336238-69336347 [-]
• Overlapping transcripts:

  sense

  ENSPTRT00000065326 ; intron 6

  ENSPTRT00000038860 ; intron 6

  ENSPTRT00000038863 ; intron 6

  ENSPTRT00000038862 ; intron 6

  ENSPTRT00000064178 ; intron 6

  ENSPTRT00000038855 ; intron 6

  ENSPTRT00000065326 ; intron 6

  ENSPTRT00000065326 ; intron 6

  ENSPTRT00000038857 ; intron 7

  ENSPTRT00000038861 ; intron 7

  ENSPTRT00000046601 ; intron 7

  ENSPTRT00000065346 ; intron 7

Database links

• EMBL: AY866197;AY866197
• ENTREZGENE: 751916;MIR204

Mature sequence ptr-miR-204

• Accession: MIMAT0002535
• Sequence: 33 - uucccuuugucauccuaugccu - 54
• Evidence: by similarity; MI0000284
• Predicted targets:
  • TARGETSCAN-VERT:ptr-miR-204

References

1. PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).