Stem-loop sequence lla-mir-199a

AccessionMI0002836 (change log)
DescriptionLagothrix lagotricha miR-199a stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
   aggaagcuucuggagauccu    c   gcc       u        c   --uca  ac 
5'                     gcuc guc   ccagugu cagacuac ugu     gg  a
                       |||| |||   ||||||| |||||||| |||     ||   
3'                     cggg cag   gguuaca gucugaug aca     cc  a
   ---------acaagagggaa    u   auu       c        -   uguug  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence lla-miR-199a

Accession MIMAT0002533
Sequence

31 - 

cccaguguucagacuaccuguuc

 - 53

Get sequence
Evidence by similarity; MI0000281

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).