Stem-loop sequence ppa-mir-196

AccessionMI0002829 (change log)
DescriptionPan paniscus miR-196 stem-loop
Gene family MIPF0000031; mir-196
Stem-loop
   -ug    - -uc       --c                  a          a ug   
5'    cucg c   agcugau   uguggcuuagguaguuuc uguuguuggg u  ag 
      |||| |   |||||||   |||||||||||||||||| |||||||||| |  | u
3'    gagc g   uuggcug   acauugaguccgucaaag acaacggcuc a  uu 
   cgg    u cuu       acu                  a          a gu   
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (panpan1.1; GCA_000258655.2) Overlapping transcripts
chr12: 35551696-35551805 [-]
intergenic
Database links

Mature sequence ppa-miR-196

Accession MIMAT0002526
Sequence

25 - 

uagguaguuucauguuguuggg

 - 46

Get sequence
Evidence by similarity; MI0000279

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).