Stem-loop sequence ppy-mir-196-1

AccessionMI0002823 (change log)
DescriptionPongo pygmaeus miR-196-1 stem-loop
Gene family MIPF0000031; mir-196
Stem-loop
         ua   a    c         - gc ugg 
5' gugaau  ggu guuu auguuguug g  c   g
   ||||||  ||| |||| ||||||||| |  |   u
3' cacuua  cca caaa uacaacaac c  g   u
         gc   c    u         a aa ucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
NW_002963091.1: 1600269-1600338 [-]
intergenic
Database links

Mature sequence ppy-miR-196

Accession MIMAT0002521
Sequence

7 - 

uagguaguuucauguuguugg

 - 27

Get sequence
Evidence by similarity; MI0000238

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).