Stem-loop sequence mml-mir-196a-1

AccessionMI0002821 (change log)
Previous IDsmml-mir-196
DescriptionMacaca mulatta miR-196a-1 stem-loop
Gene family MIPF0000031; mir-196
Literature search

1 open access papers mention mml-mir-196a-1
(1 sentences)

Stem-loop
         ua   a    c         - gc ugg 
5' gugaau  ggu guuu auguuguug g  c   g
   ||||||  ||| |||| ||||||||| |  |   u
3' cacuua  cca caaa uacaacaac c  g   u
         gc   c    u         a aa ucu 
Get sequence
Deep sequencing
157380 reads, 900 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr16: 41255188-41255257 [+]
antisense
ENSMMUT00000024267 ; CACNA1G-201; intron 7
ENSMMUT00000024263 ; CACNA1G-202; intron 7
ENSMMUT00000024264 ; CACNA1G-203; intron 7
ENSMMUT00000024265 ; CACNA1G-204; intron 7
ENSMMUT00000024262 ; CACNA1G-205; intron 7
ENSMMUT00000041840 ; CACNA1G-206; intron 7
ENSMMUT00000024136 ; CACNA1G-207; intron 7
Database links

Mature sequence mml-miR-196a-5p

Accession MIMAT0002519
Previous IDsmml-miR-196
Sequence

7 - 

uagguaguuucauguuguugg

 - 27

Get sequence
Deep sequencing315992 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).