![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ggo-mir-181c |
||||||
Accession | MI0002813 (change log) | |||||
Description | Gorilla gorilla miR-181c stem-loop | |||||
Gene family | MIPF0000007; mir-181 | |||||
Stem-loop |
c -aaauuug a g ug gaa cu a ggca 5' gga cca gg uu ggg cauucaac gucggug guuug g ||| ||| || || ||| |||||||| ||||||| ||||| c 3' ccu ggu cc ga ccc gugaguug cagcuac caaac u u accguuaa - g gu -ag -c - ggac |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence ggo-miR-181c |
|
Accession | MIMAT0002511 |
Sequence |
27 - aacauucaaccugucggugagu - 48 |
Evidence | by similarity; MI0000271 |
References |
|
1 |
PMID:15652478
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|