Stem-loop sequence ptr-mir-181c

AccessionMI0002812 (change log)
DescriptionPan troglodytes miR-181c stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   c   -aaauuug   a  g  ug   gaa        cu       a     ggca 
5'  gga        cca gg uu  ggg   cauucaac  gucggug guuug    g
    |||        ||| || ||  |||   ||||||||  ||||||| |||||    c
3'  ccu        ggu cc ga  ccc   gugaguug  cagcuac caaac    u
   u   accguuaa   -  g  gu   -ag        -c       -     ggac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 14620816-14620925 [+]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-181c
ptr-mir-181cchr19: 14620816-14620925 [+]
ptr-mir-181dchr19: 14620993-14621128 [+]
Database links

Mature sequence ptr-miR-181c

Accession MIMAT0002510
Sequence

27 - 

aacauucaaccugucggugagu

 - 48

Get sequence
Evidence by similarity; MI0000271
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).