Stem-loop sequence mml-mir-181c

AccessionMI0002811 (change log)
DescriptionMacaca mulatta miR-181c stem-loop
Gene family MIPF0000007; mir-181
Literature search

3 open access papers mention mml-mir-181c
(4 sentences)

Stem-loop
   c   -gaauuug   ag     g    aa        cu       a     ggca 
5'  gga        cca  gguuu gggg  cauucaac  gucggug guuug    g
    |||        |||  ||||| ||||  ||||||||  ||||||| |||||    c
3'  ccu        ggu  ccaga uccc  gugaguug  cagcuac caaac    u
   u   accguuca   --     g    ag        -c       -     ggac 
Get sequence
Deep sequencing
134087 reads, 589 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [2]. The expression of this mature miRNA was validated by Miska et al [1].

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 13878531-13878640 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-181c
mml-mir-181cchr19: 13878531-13878640 [+]
mml-mir-181dchr19: 13878707-13878843 [+]
Database links

Mature sequence mml-miR-181c-5p

Accession MIMAT0002509
Sequence

27 - 

aacauucaaccugucggugagu

 - 48

Get sequence
Deep sequencing92486 reads, 9 experiments
Evidence experimental; cloned [1], Illumina [3]
Database links
Predicted targets

Mature sequence mml-miR-181c-3p

Accession MIMAT0026587
Sequence

67 - 

ccaucgaccguugaguggacc

 - 87

Get sequence
Deep sequencing41599 reads, 9 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).