Stem-loop sequence mml-mir-181c

Accession MI0002811
Description Macaca mulatta miR-181c stem-loop
Gene family MIPF0000007; mir-181
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-181_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-181 microRNA precursor is a small non-coding RNA molecule. MicroRNAs (miRNAs) are transcribed as ~70 nucleotide precursors and subsequently processed by the RNase-III type enzyme Dicer to give a ~22 nucleotide mature product. In this case the mature sequence comes from the 5' arm of the precursor. They target and modulate protein expression by inhibiting translation and / or inducing degradation of target messenger RNAs. This new class of genes has recently been shown to play a central role in malignant transformation. miRNA are downregulated in many tumors and thus appear to function as tumor suppressor genes. The mature products miR-181a, miR-181b, miR-181c or miR-181d are thought to have regulatory roles at posttranscriptional level, through complementarity to target mRNAs. miR-181 which has been predicted or experimentally confirmed in a wide number of vertebrate species as rat, zebrafish, and in the pufferfish (see below) (MIPF0000007).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c   -gaauuug   ag     g    aa        cu       a     ggca 
 gga        cca  gguuu gggg  cauucaac  gucggug guuug    g
 |||        |||  ||||| ||||  ||||||||  ||||||| |||||    c
 ccu        ggu  ccaga uccc  gugaguug  cagcuac caaac    u
u   accguuca   --     g    ag        -c       -     ggac 
Get sequence
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [2]. The expression of this mature miRNA was validated by Miska et al [1].

Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 13558499-13558608 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-181c
mml-mir-181c 19: 13558499-13558608 [+]
mml-mir-181d 19: 13558675-13558811 [+]
Database links

Mature sequence mml-miR-181c

Accession MIMAT0002509
Sequence

27 - 

aacauucaaccugucggugagu

 - 48

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).