Stem-loop sequence ptr-mir-181a-2

AccessionMI0002807 (change log)
Previous IDsptr-mir-181a
DescriptionPan troglodytes miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   agaagggcuaucaggccagccuuca             a   u      cu       a    ggga 
5'                          gaggacuccaagg aca ucaacg  gucggug guuu    u
                            ||||||||||||| ||| ||||||  ||||||| ||||    u
3'                          uuccugggguucc ugu aguugc  cagucac caaa    u
   ------------------------a             a   c      --       -    aaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr9: 102766897-102767006 [+]
antisense
ENSPTRT00000039503 ; NR6A1-202; intron 2
Clustered miRNAs
< 10kb from ptr-mir-181a-2
ptr-mir-181a-2chr9: 102766897-102767006 [+]
ptr-mir-181b-2chr9: 102768161-102768248 [+]
Database links

Mature sequence ptr-miR-181a-5p

Accession MIMAT0002505
Previous IDsptr-miR-181a
Sequence

39 - 

aacauucaacgcugucggugagu

 - 61

Get sequence
Evidence by similarity; MI0000289
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).