Stem-loop sequence ppa-mir-181a-2

AccessionMI0002806 (change log)
Previous IDsppa-mir-181a
DescriptionPan paniscus miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   agaagggcuaucaggccagccuuca             a   u      cu       a    ggga 
5'                          gaggacuccaagg aca ucaacg  gucggug guuu    u
                            ||||||||||||| ||| ||||||  ||||||| ||||    u
3'                          uuccugggguucc ugu aguugc  cagucac caaa    u
   ------------------------a             a   c      --       -    aaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (panpan1.1; GCA_000258655.2) Overlapping transcripts
chr9: 124334867-124334976 [+]
intergenic
Database links

Mature sequence ppa-miR-181a-5p

Accession MIMAT0002504
Previous IDsppa-miR-181a
Sequence

39 - 

aacauucaacgcugucggugagu

 - 61

Get sequence
Evidence by similarity; MI0000289

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).