Stem-loop sequence lla-mir-34a

Accession MI0002803
Description Lagothrix lagotricha miR-34a stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network of proteins; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-    -a  --    -  ug     uu        -   a          gugag  a 
 ggcc  gc  ugug ag  uuucu  ggcagugu cuu gcugguuguu     ca u
 ||||  ||  |||| ||  |||||  |||||||| ||| ||||||||||     ||  
 ccgg  ug  gcac uc  gaaga  ccgucaua gaa cgacuaacga     gu a
c    gg  uu    g  gu     uc        u   -          aggaa  g 
Get sequence
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence lla-miR-34a

Accession MIMAT0002501
Sequence

22 - 

uggcagugucuuagcugguugu

 - 43

Get sequence
Evidence by similarity; MI0000268
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).