Stem-loop sequence mml-mir-34a

AccessionMI0002801 (change log)
DescriptionMacaca mulatta miR-34a stem-loop
Gene family MIPF0000039; mir-34
Literature search

4 open access papers mention mml-mir-34a
(8 sentences)

Stem-loop
   -    -a  --    -  ug     uu        -   a          -guga  a 
5'  ggcc  gc  ugug ag  uuucu  ggcagugu cuu gcugguuguu     gc a
    ||||  ||  |||| ||  |||||  |||||||| ||| ||||||||||     ||  
3'  ccgg  ug  acac uc  gaaga  ccgucaua gaa cgacuaacga     ug u
   u    gg  uu    a  gu     uc        u   -          aggaa  a 
Get sequence
Deep sequencing
8268 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 8320927-8321036 [-]
antisense
ENSMMUT00000023478 ; H6PD-201; intron 3
ENSMMUT00000047594 ; H6PD-202; intron 3
Database links

Mature sequence mml-miR-34a-5p

Accession MIMAT0002499
Sequence

22 - 

uggcagugucuuagcugguugu

 - 43

Get sequence
Deep sequencing8227 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-34a-3p

Accession MIMAT0026586
Sequence

65 - 

aaucagcaaguauacugcccua

 - 86

Get sequence
Deep sequencing38 reads, 6 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).