Stem-loop sequence ggo-mir-34a

AccessionMI0002796 (change log)
DescriptionGorilla gorilla miR-34a stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   -    -a  --    -  ug     uu        -   a          -guga  a 
5'  ggcc  gc  ugug ag  uuucu  ggcagugu cuu gcugguuguu     gc a
    ||||  ||  |||| ||  |||||  |||||||| ||| ||||||||||     ||  
3'  ccgg  ug  gcac uc  gaaga  ccgucaua gaa cgacuaacga     ug u
   c    gg  uu    g  gu     uc        u   -          aggaa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr1: 8834473-8834582 [-]
intergenic
Database links

Mature sequence ggo-miR-34a

Accession MIMAT0002494
Sequence

22 - 

uggcagugucuuagcugguugu

 - 43

Get sequence
Evidence by similarity; MI0000268

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).